WormMine: Gene WBGene00030415

• WormBase Gene ID: WBGene00030415
• Gene Name: Cbr-mlk-1
• Sequence Name: CBG08663
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans mlk-1. In C. elegans, mlk-1 is involved in several processes, including MAPK cascade; determination of adult lifespan; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08663b.1	CBG08663b.1		[unknown]
Transcript:CBG08663a.1	CBG08663a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08663b	CBG08663b		[unknown]
CDS:CBG08663a	CBG08663a		[unknown]

0 RNAi Result

8 Allele

• WBVar00113887
• WBVar00113886
• WBVar00113885
• WBVar00113889
• WBVar00113888
• WBVar00113890
• WBVar00113892
• WBVar00113891

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068526
• Remark: Cbr-mlk-1, GAACACCGAGGAATCATGGATCAGGAGATTCTGAAGCAGACCGAAATCGGCGGAGAAATC, WBGene00030415
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region