WormMine: Gene WBGene00030453

• WormBase Gene ID: WBGene00030453
• Gene Name: Cbr-dlk-1
• Sequence Name: CBG08707
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans dlk-1. In C. elegans, dlk-1 is involved in several processes, including p38MAPK cascade; regulation of axon extension; and sprouting of injured axon.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08707a.1	CBG08707a.1		[unknown]
Transcript:CBG08707c.1	CBG08707c.1		[unknown]
Transcript:CBG08707b.1	CBG08707b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08707a	CBG08707a		[unknown]
CDS:CBG08707c	CBG08707c		[unknown]
CDS:CBG08707b	CBG08707b		[unknown]

0 RNAi Result

13 Allele

• WBVar00113942
• WBVar00113941
• WBVar00113940
• WBVar00113946
• WBVar00113945
• WBVar00113944
• WBVar00113943
• WBVar00113935
• WBVar00113933
• WBVar00113939
• WBVar00113938
• WBVar00113937
• WBVar00113936

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054282
• Remark: Cbr-dlk-1, ATCATTCATCAACGTATTGAAGAATATTCGTCGTCTGCCACAGAAGATAGTGATGACGCT, WBGene00030453
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region