WormMine: Gene WBGene00030469

• WormBase Gene ID: WBGene00030469
• Gene Name: Cbr-unc-101
• Sequence Name: CBG08724
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in intracellular protein transport and vesicle-mediated transport. Predicted to be part of clathrin adaptor complex. Is an ortholog of C. elegans unc-101. In C. elegans, unc-101 is involved in several processes, including cilium assembly; nematode larval development; and protein localization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08724.1	CBG08724.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08724	CBG08724		[unknown]

0 RNAi Result

1 Allele

• WBVar00113958

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065585
• Remark: CBG08724, GTTGTAATCTACGAGTTGCTTGATGAAATGATGGATTTCGGTTTCCCACAAACCACAGAA, WBGene00030469
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region