WormMine: Gene WBGene00030561

• WormBase Gene ID: WBGene00030561
• Gene Name: Cbr-nex-4
• Sequence Name: CBG08840
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium ion binding activity and calcium-dependent phospholipid binding activity. Is an ortholog of C. elegans nex-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08840a.1	CBG08840a.1		[unknown]
Transcript:CBG08840b.1	CBG08840b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08840a	CBG08840a		[unknown]
CDS:CBG08840b	CBG08840b		[unknown]

0 RNAi Result

40 Allele

• WBVar00136989
• WBVar00136990
• WBVar00136992
• WBVar00136991
• WBVar00136994
• WBVar00136993
• WBVar00136996
• WBVar00136995
• WBVar00136998
• WBVar00136997
• WBVar00136999
• WBVar00114125
• WBVar00114124
• WBVar00114129
• WBVar00114128
• WBVar00114127
• WBVar00114126
• WBVar00114132
• WBVar00114131
• WBVar00114130
• WBVar00114136
• WBVar00114135
• WBVar00114134
• WBVar00114133
• WBVar00010307
• WBVar00010302
• WBVar00010347
• WBVar00010342
• WBVar00010337
• WBVar00010332

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069956
• Remark: Cbr-nex-4, CTCGAGTACAAACGCAAGTTCAACCGCGCCTTGGAGACCGACATCAGCATGTACACATCT, WBGene00030561
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region