WormMine: Gene WBGene00030575

• WormBase Gene ID: WBGene00030575
• Gene Name: CBG08854
• Sequence Name: CBG08854
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable glutathione hydrolase activity. Predicted to be involved in glutathione catabolic process. Is an ortholog of C. elegans T19H12.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08854a.1	CBG08854a.1		[unknown]
Transcript:CBG08854c.1	CBG08854c.1		[unknown]
Transcript:CBG08854b.1	CBG08854b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08854c	CBG08854c		[unknown]
CDS:CBG08854a	CBG08854a		[unknown]
CDS:CBG08854b	CBG08854b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058090
• Remark: CBG08854, CAACCTGGGAAGGTACCAACGACAATGATTTCTCCCATTATTGTGGTGAAAAATAATTCG, WBGene00030575
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region