WormMine: Gene WBGene00030582

• WormBase Gene ID: WBGene00030582
• Gene Name: CBG08862
• Sequence Name: CBG08862
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable phospholipase A2 activity. Predicted to be involved in arachidonic acid secretion and phospholipid metabolic process. Is an ortholog of C. elegans H23N18.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08862.1	CBG08862.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08862	CBG08862		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059127
• Remark: CBG08862, TTCCAAATGGAGAACTTTTGCAACACCGCCAAAAGCTTCGGAGGATTCCATTTCAAGGGA, WBGene00030582
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region