WormMine: Gene WBGene00030668

• WormBase Gene ID: WBGene00030668
• Gene Name: Cbr-pst-2
• Sequence Name: CBG08992
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in transmembrane transport. Is an ortholog of C. elegans pst-2. In C. elegans, pst-2 is involved in 3'-phosphoadenosine 5'-phosphosulfate transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08992.1	CBG08992.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08992	CBG08992		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054461
• Remark: Cbr-pst-2, CTATGCTGGATCCGTTGTGATGCTGGCGATTTATTTGAACTTGTACAGTAAGAACAAAGC, WBGene00030668
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region