WormMine: Gene WBGene00030713

• WormBase Gene ID: WBGene00030713
• Gene Name: Cbr-tdo-2
• Sequence Name: CBG09046
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable heme binding activity; metal ion binding activity; and tryptophan 2,3-dioxygenase activity. Predicted to be involved in tryptophan catabolic process to kynurenine. Is an ortholog of C. elegans tdo-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09046.1	CBG09046.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09046	CBG09046		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051188
• Remark: CBG09046, CCAGGATTGAAGTCAACTTCAGAAGACGAAGGATTCTGGAGCAAGTATGAGAGTTCGGTT, WBGene00030713
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region