WormMine: Gene WBGene00030741

• WormBase Gene ID: WBGene00030741
• Gene Name: Cbr-mdt-15
• Sequence Name: CBG09077
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable transcription coregulator activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans mdt-15. In C. elegans, mdt-15 is involved in several processes, including determination of adult lifespan; regulation of primary metabolic process; and sequestering of triglyceride.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09077.1	CBG09077.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09077	CBG09077		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066889
• Remark: Cbr-mdt-15, GATCGATTTGGATGCCTATCTCTATGATGATCTACAAAACGTTGTGCACGAACGATTATC, WBGene00030741
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region