WormMine: Gene WBGene00030749

• WormBase Gene ID: WBGene00030749
• Gene Name: Cbr-ceh-10
• Sequence Name: CBG09085
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity. Is an ortholog of C. elegans ceh-10. In C. elegans, ceh-10 is involved in several processes, including egg-laying behavior; generation of neurons; and positive regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09085.1	CBG09085.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09085	CBG09085		[unknown]

0 RNAi Result

9 Allele

• WBVar00137026
• WBVar00114392
• WBVar00114391
• WBVar00114390
• WBVar00114395
• WBVar00114394
• WBVar00114393
• WBVar00114389
• WBVar00114388

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062842
• Remark: Cbr-ceh-10, CAATATCAAATTGATGAACTCGAGAAGGCGTTCCAAGAGGCTCACTATCCGGATGTCTAT, WBGene00030749
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region