WormMine: Gene WBGene00030751

• WormBase Gene ID: WBGene00030751
• Gene Name: Cbr-him-10
• Sequence Name: CBG09087
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in kinetochore. Predicted to be part of Ndc80 complex. Is an ortholog of C. elegans him-10. In C. elegans, him-10 is involved in kinetochore organization; mitotic spindle organization; and nuclear chromosome segregation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09087.1	CBG09087.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09087	CBG09087		[unknown]

0 RNAi Result

2 Allele

• WBVar00114396
• WBVar00114397

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063382
• Remark: Cbr-him-10, AGAGCTTCTCGCTGCCAAAAATGCTCACAGTGAAAAGATGGCTCTTATCAACAACGCACA, WBGene00030751
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region