WormMine: Gene WBGene00030756

• WormBase Gene ID: WBGene00030756
• Gene Name: Cbr-ida-1
• Sequence Name: CBG09094
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein tyrosine phosphatase activity. Predicted to be located in secretory granule. Is an ortholog of C. elegans ida-1. In C. elegans, ida-1 is involved in positive regulation of anterior/posterior axon guidance; positive regulation of neurotransmitter secretion; and ventral cord development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09094.1	CBG09094.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09094	CBG09094		[unknown]

0 RNAi Result

22 Allele

• WBVar00114437
• WBVar00114436
• WBVar00114435
• WBVar00114434
• WBVar00114439
• WBVar00114438
• WBVar00114440
• WBVar00114444
• WBVar00114443
• WBVar00114442
• WBVar00114441
• WBVar00114429
• WBVar00114428
• WBVar00114433
• WBVar00114432
• WBVar00114431
• WBVar00114430
• WBVar00114448
• WBVar00114447
• WBVar00114446
• WBVar00114445
• WBVar00114449

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055547
• Remark: Cbr-ida-1, ATTCAAACTTGTCTATGGATGTGTCGCCCAGGAAGTCAATCATCTTCTGAAGTCAATTGC, WBGene00030756
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region