WormMine: Gene WBGene00030816

• WormBase Gene ID: WBGene00030816
• Gene Name: Cbr-mup-4
• Sequence Name: CBG09178
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium ion binding activity. Is an ortholog of C. elegans mup-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09178b.1	CBG09178b.1		[unknown]
Transcript:CBG09178c.2	CBG09178c.2		[unknown]
Transcript:CBG09178c.1	CBG09178c.1		[unknown]
Transcript:CBG09178a.1	CBG09178a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09178c	CBG09178c		[unknown]
CDS:CBG09178b	CBG09178b		[unknown]
CDS:CBG09178a	CBG09178a		[unknown]

0 RNAi Result

4 Allele

• WBVar00056904
• WBVar00056889
• WBVar00056894
• WBVar00056899

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052835
• Remark: Cbr-mup-4, GCTCGGCGGCTGCCACGTGTATTGATAAGAAGGATGGATATGAGTGCAAGTGTCAAGAAG, WBGene00030816
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region