WormMine: Gene WBGene00030885

• WormBase Gene ID: WBGene00030885
• Gene Name: Cbr-fut-8
• Sequence Name: CBG09273
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable glycoprotein 6-alpha-L-fucosyltransferase activity. Predicted to be involved in protein glycosylation. Predicted to be located in Golgi cisterna membrane. Is an ortholog of C. elegans fut-8. In C. elegans, fut-8 is involved in fucosylation and protein N-linked glycosylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09273a.1	CBG09273a.1		[unknown]
Transcript:CBG09273b.1	CBG09273b.1		[unknown]
Transcript:CBG09273c.1	CBG09273c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09273c	CBG09273c		[unknown]
CDS:CBG09273b	CBG09273b		[unknown]
CDS:CBG09273a	CBG09273a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066544
• Remark: Cbr-fut-8, CTGACGATGGATCCAAGTTCCATTCTCTTGACGACATTTATTATTTCGGTGGACAACAAG, WBGene00030885
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region