WormMine: Gene WBGene00030925

• WormBase Gene ID: WBGene00030925
• Gene Name: CBG09322
• Sequence Name: CBG09322
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metal ion binding activity. Is an ortholog of C. elegans F44E7.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09322b.1	CBG09322b.1		[unknown]
Transcript:CBG09322a.1	CBG09322a.1		[unknown]
Transcript:CBG09322c.1	CBG09322c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09322b	CBG09322b		[unknown]
CDS:CBG09322c	CBG09322c		[unknown]
CDS:CBG09322a	CBG09322a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1063490
• Remark: CBG09322, AAAAATCCGTAAAGACGCTCCTGAACGTCGGAAGCTCGCCGTTTTCGTTCACGGAAAGGG, WBGene00030925
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region