WormMine: Gene WBGene00030952

• WormBase Gene ID: WBGene00030952
• Gene Name: Cbr-acy-4
• Sequence Name: CBG09353
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable adenylate cyclase activity. Predicted to be involved in cAMP biosynthetic process and intracellular signal transduction. Predicted to be located in plasma membrane. Is an ortholog of C. elegans acy-4. In C. elegans, acy-4 is involved in oocyte growth.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09353.1	CBG09353.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09353	CBG09353		[unknown]

0 RNAi Result

7 Allele

• WBVar00031784
• WBVar00114788
• WBVar00114789
• WBVar00114790
• WBVar00114791
• WBVar00010927
• WBVar00010922

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054176
• Remark: Cbr-acy-4, ATATTTGGGGAAACAGTGTTAATGTGGCAAGTCGAATGGATAGTGGAGGAGTTGCTGGAA, WBGene00030952
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region