WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030964 Gene Name  Cbr-klc-2
Sequence Name  ? CBG09366 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be part of kinesin complex. Is an ortholog of C. elegans klc-2. In C. elegans, klc-2 is involved in several processes, including axon extension; establishment of organelle localization; and polar body extrusion after meiotic divisions. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09366b.1 CBG09366b.1   [unknown]
Transcript:CBG09366c.2 CBG09366c.2   [unknown]
Transcript:CBG09366c.1 CBG09366c.1   [unknown]
Transcript:CBG09366a.1 CBG09366a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09366b CBG09366b   [unknown]
CDS:CBG09366c CBG09366c   [unknown]
CDS:CBG09366a CBG09366a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-klc-2, ACTCTCAAAAATCTAGGAGCTCTTTACCGTCGACAAGGGAAATACGAAGCCGCTGAGACA, WBGene00030964   Expr1068335 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  part_of

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  part_of

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region