WormMine: Gene WBGene00030984

• WormBase Gene ID: WBGene00030984
• Gene Name: Cbr-acl-6
• Sequence Name: CBG09390
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable glycerol-3-phosphate O-acyltransferase activity. Predicted to be involved in phospholipid biosynthetic process. Predicted to be located in plasma membrane. Is an ortholog of C. elegans acl-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09390b.1	CBG09390b.1		[unknown]
Transcript:CBG09390a.1	CBG09390a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09390a	CBG09390a		[unknown]
CDS:CBG09390b	CBG09390b		[unknown]

0 RNAi Result

6 Allele

• WBVar00004339
• WBVar00114830
• WBVar00114831
• WBVar00114832
• WBVar00114833
• WBVar00114829

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054487
• Remark: Cbr-acl-6, CAATTCTTTGCCAATCTTGTCCGACCATTCATCCAATCATTGTATCTCGTTTCGTCATTT, WBGene00030984
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region