WormMine: Gene WBGene00031034

• WormBase Gene ID: WBGene00031034
• Gene Name: Cbr-unc-44
• Sequence Name: CBG09456
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in signal transduction. Is an ortholog of C. elegans unc-44. In C. elegans, unc-44 is involved in several processes, including axon guidance; establishment or maintenance of cytoskeleton polarity; and regulation of cellular component organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09456.1	CBG09456.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09456	CBG09456		[unknown]

0 RNAi Result

36 Allele

• WBVar00137081
• WBVar00137080
• WBVar00137083
• WBVar00137082
• WBVar00137085
• WBVar00137084
• WBVar00137087
• WBVar00137086
• WBVar00137089
• WBVar00137088
• WBVar00137090
• WBVar00137092
• WBVar00137091
• WBVar00137094
• WBVar00137093
• WBVar00137096
• WBVar00137095
• WBVar00137079
• WBVar00043769
• WBVar00043774
• WBVar00114900
• WBVar00114901
• WBVar00114902
• WBVar00114903
• WBVar00114904
• WBVar00114905
• WBVar00114906
• WBVar00114907
• WBVar00014779
• WBVar00014774

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated
	C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1055451
• Remark: CBG09456, CTCGGTTCCCCAACAGCAAGATCAGAAGAACCAGAAGAACGGAAACATCCTGACGATCAT, WBGene00031034
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region