WormMine: Gene WBGene00031316

• WormBase Gene ID: WBGene00031316
• Gene Name: Cbr-spe-41
• Sequence Name: CBG09796
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium channel activity. Predicted to be involved in calcium ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans spe-41. In C. elegans, spe-41 is involved in calcium ion transport; intracellular calcium ion homeostasis; and single fertilization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09796.1	CBG09796.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09796	CBG09796		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1061953
• Remark: Cbr-spe-41, TTCAAATATACACGAGCAGCAATGTACGCAGAATTTGTATCCTGGGAGATGGCTGCGCCA, WBGene00031316
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region