WormMine: Gene WBGene00031365

• WormBase Gene ID: WBGene00031365
• Gene Name: Cbr-ceh-44
• Sequence Name: CBG09849
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity. Predicted to be involved in intra-Golgi vesicle-mediated transport. Predicted to be located in Golgi membrane. Is an ortholog of C. elegans ceh-44.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09849b.1	CBG09849b.1		[unknown]
Transcript:CBG09849a.1	CBG09849a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09849b	CBG09849b		[unknown]
CDS:CBG09849a	CBG09849a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058759
• Remark: Cbr-ceh-44, TACAAAGTTGGAGATGTCACTGAGAACTGTGCAAAATTGGTTCCACAATCACAGGACTCG, WBGene00031365
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region