WormMine: Gene WBGene00031400

• WormBase Gene ID: WBGene00031400
• Gene Name: Cbr-gtf-2H2C
• Sequence Name: CBG09887
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable zinc ion binding activity. Predicted to be involved in DNA-templated transcription and nucleotide-excision repair. Predicted to be part of transcription factor TFIIH core complex. Is an ortholog of C. elegans gtf-2H2C.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09887b.1	CBG09887b.1		[unknown]
Transcript:CBG09887a.1	CBG09887a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09887a	CBG09887a		[unknown]
CDS:CBG09887b	CBG09887b		[unknown]

0 RNAi Result

1 Allele

• WBVar00001629

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068112
• Remark: CBG09887, AAGTTCTTTGACAGAAGCATTCTGTGGTGGAGATTTTTCTTTACAAAACGCTCTCCAGCT, WBGene00031400
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region