WormMine: Gene WBGene00031498

• WormBase Gene ID: WBGene00031498
• Gene Name: Cbr-hlh-4
• Sequence Name: CBG10010
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein dimerization activity. Is an ortholog of C. elegans hlh-4. In C. elegans, hlh-4 is involved in positive regulation of transcription by RNA polymerase II and response to food.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10010.2	CBG10010.2		[unknown]
Transcript:CBG10010.1	CBG10010.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10010	CBG10010		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063968
• Remark: Cbr-hlh-4, AAATCCATCTCAATCAGCATCTTCCCATTTGATTGTCAATAATCCTCTGGTTCCAATTCC, WBGene00031498
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region