Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG03650.1 | CBG03650.1 | [unknown] |
Other
10 Allele
Public Name |
---|
WBVar00108636 |
WBVar00108635 |
WBVar00108643 |
WBVar00108642 |
WBVar00108641 |
WBVar00108640 |
WBVar00108639 |
WBVar00108638 |
WBVar00108637 |
WBVar00041907 |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG03650, CTGCCGAAGACATGCCGTTGTACAAAAAACAAAGTGTCTACATCACGGTTCTGTCGATTG, WBGene00026466 | Expr1050774 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |