WormMine: Gene WBGene00031573

• WormBase Gene ID: WBGene00031573
• Gene Name: CBG10094
• Sequence Name: CBG10094
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable NAD+ binding activity and oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor. Predicted to be involved in fatty acid metabolic process. Is an ortholog of C. elegans F54C8.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10094.1	CBG10094.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10094	CBG10094		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067301
• Remark: CBG10094, GACATTTGCACCAAGCCCGCTTATCGATGCCCTAGTTTCCGAAGGAAAACTAGGAAGAAA, WBGene00031573
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region