WormMine: Gene WBGene00031766

• WormBase Gene ID: WBGene00031766
• Gene Name: Cbr-nhr-181
• Sequence Name: CBG10365
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans nhr-181.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10365.1	CBG10365.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10365	CBG10365		[unknown]

0 RNAi Result

28 Allele

• WBVar00037989
• WBVar00037984
• WBVar00037994
• WBVar00037999
• WBVar00037959
• WBVar00037954
• WBVar00037969
• WBVar00037964
• WBVar00037979
• WBVar00037974
• WBVar00115730
• WBVar00115731
• WBVar00115743
• WBVar00115744
• WBVar00115745
• WBVar00115736
• WBVar00115737
• WBVar00115738
• WBVar00115739
• WBVar00115732
• WBVar00115733
• WBVar00115734
• WBVar00115735
• WBVar00115740
• WBVar00115741
• WBVar00115742
• WBVar00010029
• WBVar00010024

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062593
• Remark: Cbr-nhr-181, GTCAAAGCAATCTACAATCATACACGCGTCTCGGACATCTTCCATCTGATGACGTTCGAT, WBGene00031766
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region