WormMine: Gene WBGene00031801

• WormBase Gene ID: WBGene00031801
• Gene Name: CBG10411
• Sequence Name: CBG10411
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable heme binding activity and peroxidase activity. Predicted to be involved in response to oxidative stress. Is an ortholog of C. elegans R08F11.7. In C. elegans, R08F11.7 is involved in defense response to Gram-positive bacterium.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10411.1	CBG10411.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10411	CBG10411		[unknown]

0 RNAi Result

38 Allele

• WBVar00045967
• WBVar00045962
• WBVar00045972
• WBVar00045977
• WBVar00045982
• WBVar00045987
• WBVar00045992
• WBVar00045997
• WBVar00045927
• WBVar00045922
• WBVar00045937
• WBVar00045932
• WBVar00045947
• WBVar00045942
• WBVar00045957
• WBVar00045952
• WBVar00045902
• WBVar00045907
• WBVar00045912
• WBVar00045917
• WBVar00045857
• WBVar00045852
• WBVar00045862
• WBVar00045867
• WBVar00045872
• WBVar00045877
• WBVar00045892
• WBVar00045882
• WBVar00045887
• WBVar00045897

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058584
• Remark: CBG10411, ATTATTGCTGAGCAATTCCGAGCGCTCAAAACTGGAGACAGATTCTACTACGAGAACCAG, WBGene00031801
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region