WormMine: Gene WBGene00031970

• WormBase Gene ID: WBGene00031970
• Gene Name: Cbr-irk-3
• Sequence Name: CBG10649
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable inward rectifier potassium channel activity. Predicted to be involved in potassium ion transport. Predicted to be located in membrane. Is an ortholog of C. elegans irk-3. In C. elegans, irk-3 is involved in short-term memory.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10649a.1	CBG10649a.1		[unknown]
Transcript:CBG10649b.1	CBG10649b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10649b	CBG10649b		[unknown]
CDS:CBG10649a	CBG10649a		[unknown]

0 RNAi Result

6 Allele

• WBVar00031474
• WBVar00031479
• WBVar00031484
• WBVar00031489
• WBVar00031494
• WBVar00116027

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052742
• Remark: Cbr-irk-3, ACCAATGGTACTAATGAACGAAAAACTTTCGAAATATGAGGTTCACTACTCACTTTTTGA, WBGene00031970
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region