WormMine: Gene WBGene00032065

• WormBase Gene ID: WBGene00032065
• Gene Name: Cbr-chd-1
• Sequence Name: CBG10790
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and ATP-dependent chromatin remodeler activity. Is an ortholog of C. elegans chd-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10790.1	CBG10790.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10790	CBG10790		[unknown]

0 RNAi Result

33 Allele

• WBVar00116182
• WBVar00116183
• WBVar00116184
• WBVar00116185
• WBVar00116180
• WBVar00116181
• WBVar00116186
• WBVar00116187
• WBVar00116188
• WBVar00116189
• WBVar00116171
• WBVar00116172
• WBVar00116173
• WBVar00116174
• WBVar00116170
• WBVar00116179
• WBVar00116175
• WBVar00116176
• WBVar00116177
• WBVar00116178
• WBVar00116190
• WBVar00116160
• WBVar00116161
• WBVar00116162
• WBVar00116163
• WBVar00116168
• WBVar00116169
• WBVar00116164
• WBVar00116165
• WBVar00116166

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066872
• Remark: CBG10790, CTAAAGAGAAGAACCATCGACCAGAGAAAAGAAAAGACCATAGAGAAGGAACGAGCAGGG, WBGene00032065
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region