WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032069 Gene Name  Cbr-lfe-2
Sequence Name  ? CBG10794 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable kinase activity. Predicted to be involved in inositol phosphate biosynthetic process. Is an ortholog of C. elegans lfe-2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG10794c.1 CBG10794c.1   [unknown]
Transcript:CBG10794b.1 CBG10794b.1   [unknown]
Transcript:CBG10794a.1 CBG10794a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG10794c CBG10794c   [unknown]
CDS:CBG10794a CBG10794a   [unknown]
CDS:CBG10794b CBG10794b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-lfe-2, TTTGAATCACCGCACGAATTGGGTTCCAGGAAACAATGAGGATGGATATCTGATAGGAAT, WBGene00032069   Expr1059433 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG10793, AAATTCCAACACCGTCGGTATGCGATCATCGGGACACAATGAATTCCGATGCATCGTCAA, WBGene00032068   Expr1065170 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG10795, CGTAAGAGATCGGGAAAGGCATTGAGATTTGTTCGTCCGAAATTAGCTGACATTTGGCAT, WBGene00032070   Expr1056176 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  involved_in
  enables

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region