WormMine: Gene WBGene00032082

• WormBase Gene ID: WBGene00032082
• Gene Name: Cbr-spe-5
• Sequence Name: CBG10811
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and proton-transporting ATPase activity, rotational mechanism. Predicted to be involved in ATP metabolic process and proton transmembrane transport. Predicted to be part of proton-transporting V-type ATPase, V1 domain. Is an ortholog of C. elegans spe-5. In C. elegans, spe-5 is involved in intracellular pH reduction; positive regulation of programmed cell death; and spermatocyte division.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10811.1	CBG10811.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10811	CBG10811		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_upregulated
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1052328
• Remark: Cbr-tag-300, TTCCCACGAGAGATGCTCAAAAGAATCCAAGAGCCAATTCTCGAAAAATACTACCCAAGA, WBGene00032082
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region