WormMine: Gene WBGene00032103

• WormBase Gene ID: WBGene00032103
• Gene Name: Cbr-ceh-60
• Sequence Name: CBG10835
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity and DNA-binding transcription factor activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans ceh-60. In C. elegans, ceh-60 is involved in dopaminergic neuron differentiation and regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10835a.1	CBG10835a.1		[unknown]
Transcript:CBG10835b.1	CBG10835b.1		[unknown]
Transcript:CBG10835c.1	CBG10835c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10835a	CBG10835a		[unknown]
CDS:CBG10835b	CBG10835b		[unknown]
CDS:CBG10835c	CBG10835c		[unknown]

0 RNAi Result

1 Allele

• WBVar00012442

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068429
• Remark: Cbr-ceh-60, GCCATTGGTGAATCCTGCAATGCAAGCAATGATGATTCCTAGCGTTCAACCTACCGTAAT, WBGene00032103
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region