WormMine: Gene WBGene00032118

• WormBase Gene ID: WBGene00032118
• Gene Name: Cbr-aexr-2
• Sequence Name: CBG10853
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable neuropeptide receptor activity. Predicted to be involved in neuropeptide signaling pathway. Is an ortholog of C. elegans aexr-2. In C. elegans, aexr-2 is involved in lysosome organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10853.1	CBG10853.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10853	CBG10853		[unknown]

0 RNAi Result

6 Allele

• WBVar00116238
• WBVar00116239
• WBVar00116240
• WBVar00116241
• WBVar00116242
• WBVar00116237

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1059938
• Remark: CBG10853, CATCCTGCAGTTTGTTGCCTTACAGAGTGGCTAATCTTGCTAGAATTCATGTTATAACGT, WBGene00032118
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region