WormMine: Gene WBGene00032125

• WormBase Gene ID: WBGene00032125
• Gene Name: CBG10863
• Sequence Name: CBG10863
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; ligase activity, forming carbon-nitrogen bonds; and phosphoribosylglycinamide formyltransferase activity. Predicted to be involved in 'de novo' IMP biosynthetic process and purine nucleobase biosynthetic process. Is an ortholog of C. elegans F38B6.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10863.1	CBG10863.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10863	CBG10863		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050993
• Remark: CBG10863, CATGCATTACAAGACGCTCTGGACTTTGGAGCAAAAGTTGTCGGATGCACTGCGCATTTT, WBGene00032125
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region