WormMine: Gene WBGene00032144

• WormBase Gene ID: WBGene00032144
• Gene Name: Cbr-sgca-1
• Sequence Name: CBG10894
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium ion binding activity. Predicted to be located in membrane. Predicted to be part of sarcoglycan complex. Is an ortholog of C. elegans sgca-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10894.1	CBG10894.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10894	CBG10894		[unknown]

0 RNAi Result

3 Allele

• WBVar00012467
• WBVar00012457
• WBVar00012462

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069195
• Remark: Cbr-sgca-1, TTCTCCCCTCTGTTGATCATATTCCCGTTGGCAAGCAAACAGTCGCAGAAGCAGCAAAGC, WBGene00032144
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region