WormMine: Gene WBGene00032243

• WormBase Gene ID: WBGene00032243
• Gene Name: Cbr-cdh-7
• Sequence Name: CBG11054
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium ion binding activity. Predicted to be involved in homophilic cell adhesion via plasma membrane adhesion molecules. Predicted to be located in membrane. Is an ortholog of C. elegans cdh-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11054.1	CBG11054.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11054	CBG11054		[unknown]

0 RNAi Result

2 Allele

• WBVar00012522
• WBVar00012517

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052979
• Remark: Cbr-cdh-7, ATGTACCGTAACCACGAAGAGCACATGTATCGGTCGCCGAATTTGAATGAAAAAGTCGGC, WBGene00032243
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region