WormMine: Gene WBGene00032277

• WormBase Gene ID: WBGene00032277
• Gene Name: CBG11091
• Sequence Name: CBG11091
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be part of NURF complex. Is an ortholog of C. elegans nurf-1. In C. elegans, nurf-1 is involved in positive regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11091c.1	CBG11091c.1		[unknown]
Transcript:CBG11091d.1	CBG11091d.1		[unknown]
Transcript:CBG11091a.1	CBG11091a.1		[unknown]
Transcript:CBG11091b.1	CBG11091b.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11091c	CBG11091c		[unknown]
CDS:CBG11091b	CBG11091b		[unknown]
CDS:CBG11091a	CBG11091a		[unknown]
CDS:CBG11091d	CBG11091d		[unknown]

0 RNAi Result

25 Allele

• WBVar00116500
• WBVar00116501
• WBVar00116506
• WBVar00116507
• WBVar00116508
• WBVar00116502
• WBVar00116503
• WBVar00116504
• WBVar00116505
• WBVar00116487
• WBVar00116488
• WBVar00116489
• WBVar00116484
• WBVar00116485
• WBVar00116486
• WBVar00116490
• WBVar00116491
• WBVar00116492
• WBVar00116493
• WBVar00116498
• WBVar00116499
• WBVar00116494
• WBVar00116495
• WBVar00116496
• WBVar00116497

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

2 Expression Patterns

• Primary Identifier: Expr1061816
• Remark: CBG11090, GTCAACGATGTGAATCTGATGTTTGAGAACGCGAAGACGTACAATCCAAAGGATAGTGCG, WBGene00032276
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1052668
• Remark: CBG11091, TCCATACGTCTCGAATCTTCTACCGTCGATTAATGATACGCCAGATGATAAAGTTATCAA, WBGene00032277
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region