WormMine: Gene WBGene00032386

• WormBase Gene ID: WBGene00032386
• Gene Name: Cbr-dpy-10
• Sequence Name: CBG11227
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be a structural constituent of cuticle. Is an ortholog of C. elegans dpy-10. In C. elegans, dpy-10 is involved in several processes, including cuticle development involved in collagen and cuticulin-based cuticle molting cycle; locomotion; and post-embryonic body morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11227.1	CBG11227.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11227	CBG11227		[unknown]

0 RNAi Result

2 Allele

• sy1387
• WBVar00012962

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058730
• Remark: Cbr-dpy-10, AGTATCCTTCTTATCAATCCAGGACCACAACCACGTATTCGTGCCGACGACTACAACAAT, WBGene00032386
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00051563

0 Upstream Intergenic Region