WormMine: Gene WBGene00032390

• WormBase Gene ID: WBGene00032390
• Gene Name: Cbr-tsp-10
• Sequence Name: CBG11232
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans tsp-10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11232.1	CBG11232.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11232	CBG11232		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated
Virus infection: Santeuil infected at L3 larva stage for 12 hours.	Transcripts that showed signicantly decreased expression after Santeuil virus infection to C. briggsae strain JU1264.	edgeR, FDR < 0.05.	WBPaper00051137:Santeuil-virus_downregulated_JU1264

1 Expression Patterns

• Primary Identifier: Expr1066134
• Remark: Cbr-tsp-10, TTTTCTGGCTGGATACCGTGCCTACACACTGGCTCATCCTGAGTTCGACGACAAATTATA, WBGene00032390
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region