WormMine: Gene WBGene00032412

• WormBase Gene ID: WBGene00032412
• Gene Name: Cbr-gcy-7
• Sequence Name: CBG11271
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; guanylate cyclase activity; and protein kinase activity. Predicted to be involved in cGMP biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-7. In C. elegans, gcy-7 is involved in chemosensory behavior; chemotaxis; and response to magnesium ion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11271.1	CBG11271.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11271	CBG11271		[unknown]

0 RNAi Result

11 Allele

• WBVar00116755
• WBVar00116756
• WBVar00116757
• WBVar00116758
• WBVar00116748
• WBVar00116749
• WBVar00116751
• WBVar00116752
• WBVar00116753
• WBVar00116754
• WBVar00116750

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057990
• Remark: Cbr-gcy-7, TTCTTCAGAATCCCACATCTTCCAAGCGAGCGTATCAATTTGAGAATCGGAATGAACTGC, WBGene00032412
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region