WormMine: Gene WBGene00032418

• WormBase Gene ID: WBGene00032418
• Gene Name: Cbr-gpa-2
• Sequence Name: CBG11277
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G-protein beta/gamma-subunit complex binding activity; GTP binding activity; and GTPase activity. Predicted to be involved in adenylate cyclase-modulating G protein-coupled receptor signaling pathway. Is an ortholog of C. elegans gpa-2. In C. elegans, gpa-2 is involved in several processes, including defense response to Gram-negative bacterium; olfactory learning; and positive regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11277.1	CBG11277.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11277	CBG11277		[unknown]

0 RNAi Result

7 Allele

• WBVar00116762
• WBVar00116763
• WBVar00116764
• WBVar00116765
• WBVar00116760
• WBVar00116761
• WBVar00116766

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055662
• Remark: Cbr-gpa-2, CAATCCGAAGAAGACGTTCTACGTTCACGAGACGTGTGCAACAGACACAAACCAAGTGCA, WBGene00032418
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region