WormMine: Gene WBGene00032465

• WormBase Gene ID: WBGene00032465
• Gene Name: Cbr-srp-7
• Sequence Name: CBG11331
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable serine-type endopeptidase inhibitor activity. Predicted to be located in extracellular space. Is an ortholog of C. elegans srp-7. In C. elegans, srp-7 is involved in IRE1-mediated unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11331a.1	CBG11331a.1		[unknown]
Transcript:CBG11331b.1	CBG11331b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11331a	CBG11331a		[unknown]
CDS:CBG11331b	CBG11331b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062437
• Remark: Cbr-srp-7, GAAGAGCCAAAAGATTTCATTGCCGATCACCCGTTCCTCTTCGTCCTCTCCCAAAACAAT, WBGene00032465
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region