WormBase Gene ID
|
WBGene00032529 | Gene Name | Cbr-end-1 |
| Sequence Name
|
CBG11413 | Brief Description | Cbr-end-1 encodes a GATA-type transcription factor that is orthologous to C. elegans end-1; Cbr-end-1 functions redundantly with Cbr-end-3.1 and Cbr-end-3.2 to specify endoderm development; expression of Cbr-end-1 in C. elegans animals deficient for the endoderm determining region (EDR) of the genome is sufficient to restore endoderm development. |
| Organism | Caenorhabditis briggsae | Automated Description | Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Is an ortholog of C. elegans end-1. In C. elegans, end-1 is involved in endodermal cell fate specification and positive regulation of transcription by RNA polymerase II. |
| Biotype | SO:0001217 | Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG11413.1 | CBG11413.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-end-1, AAACGGAGTCCAGCGGCCCGCGGATTTGTGCAATAAGCAAATTCTGAAACGAAATCGCCG, WBGene00032529 | Expr1058853 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
