WormMine: Gene WBGene00032738

• WormBase Gene ID: WBGene00032738
• Gene Name: Cbr-sea-1.4
• Sequence Name: CBG11646
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans sea-1. In C. elegans, sea-1 is involved in dosage compensation by hypoactivation of X chromosome; positive regulation of transcription by RNA polymerase II; and sex determination.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11646.1	CBG11646.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11646	CBG11646		[unknown]

0 RNAi Result

1 Allele

• WBVar00013367

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061581
• Remark: CBG11646, CAAAGTCAATCTAAGATGTCTCTACGTTCCGGTGATGACAATCTACGAAGATGACCGTAA, WBGene00032738
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region