WormMine: Gene WBGene00032795

• WormBase Gene ID: WBGene00032795
• Gene Name: Cbr-cisd-3.2
• Sequence Name: CBG11715
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable 2 iron, 2 sulfur cluster binding activity. Predicted to be located in intracellular membrane-bounded organelle. Is an ortholog of C. elegans cisd-3.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11715.1	CBG11715.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11715	CBG11715		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052114
• Remark: CBG11715, GAAAAAACCGGCGACTACTCAATGTGCGGATGCAAACAGACCGATTCTCGACCACTTTGC, WBGene00032795
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region