WormMine: Gene WBGene00032799

• WormBase Gene ID: WBGene00032799
• Gene Name: Cbr-snf-6
• Sequence Name: CBG11720
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans snf-6. In C. elegans, snf-6 is involved in acetylcholine transport; choline transport; and positive regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11720.1	CBG11720.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11720	CBG11720		[unknown]

0 RNAi Result

20 Allele

• WBVar00117449
• WBVar00117448
• WBVar00117450
• WBVar00117456
• WBVar00117455
• WBVar00117458
• WBVar00117457
• WBVar00117452
• WBVar00117451
• WBVar00117454
• WBVar00117453
• WBVar00117445
• WBVar00117447
• WBVar00117446
• WBVar00117459
• WBVar00117461
• WBVar00117460
• WBVar00117463
• WBVar00117462
• WBVar00117464

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067923
• Remark: Cbr-snf-6, TGTTTCCTCTGGCTGGATTGGAATTCAATAGAATACGAATCATATCAATTCCCATATTGG, WBGene00032799
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region