WormMine: Gene WBGene00032812

• WormBase Gene ID: WBGene00032812
• Gene Name: CBG11735
• Sequence Name: CBG11735
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable kinase activity. Predicted to be involved in inositol phosphate biosynthetic process. Is an ortholog of C. elegans Y22D7AR.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11735.1	CBG11735.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11735	CBG11735		[unknown]

0 RNAi Result

26 Allele

• cbp40164
• cbp40165
• cbp40166
• cbp40167
• cbp40162
• cbp40163
• cbp40168
• cbp40169
• cbp40170
• cbp40161
• WBVar00117470
• WBVar00117472
• WBVar00117471
• WBVar00117478
• WBVar00117477
• WBVar00117479
• WBVar00117474
• WBVar00117473
• WBVar00117476
• WBVar00117475
• WBVar00117467
• WBVar00117466
• WBVar00117469
• WBVar00117468
• WBVar00117465
• WBVar00117480

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1056819
• Remark: CBG11735, AAGGAAAAGATGAGGGATCAATTTTGGGTCTGGACACTTTGCTAGGCATTGTGAAGCGCT, WBGene00032812
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region