WormMine: Gene WBGene00032820

• WormBase Gene ID: WBGene00032820
• Gene Name: Cbr-polh-1
• Sequence Name: CBG11743
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable damaged DNA binding activity. Predicted to be involved in DNA repair. Is an ortholog of C. elegans polh-1. In C. elegans, polh-1 is involved in embryo development; error-prone translesion synthesis; and negative regulation of mitotic DNA damage checkpoint.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11743.1	CBG11743.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11743	CBG11743		[unknown]

0 RNAi Result

20 Allele

• WBVar00117548
• WBVar00117547
• WBVar00117549
• WBVar00117555
• WBVar00117554
• WBVar00117557
• WBVar00117556
• WBVar00117551
• WBVar00117550
• WBVar00117553
• WBVar00117552
• WBVar00117539
• WBVar00117544
• WBVar00117543
• WBVar00117546
• WBVar00117545
• WBVar00117540
• WBVar00117542
• WBVar00117541
• WBVar00117558

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066756
• Remark: Cbr-polh-1, GATTGGTGAAAGAGCTGGCGAAACGATTGGGGACGGATCAGGCTGAAAACAAGAGAACTG, WBGene00032820
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region