WormMine: Gene WBGene00032830

• WormBase Gene ID: WBGene00032830
• Gene Name: Cbr-pie-1
• Sequence Name: CBG11755
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metal ion binding activity. Is an ortholog of C. elegans pie-1. In C. elegans, pie-1 is involved in several processes, including embryonic pattern specification; formation of primary germ layer; and negative regulation of macromolecule metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11755.1	CBG11755.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11755	CBG11755		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067114
• Remark: Cbr-pie-1, ATGCCGCTACCTGCACCAAGAGCAACTTCCCCAATTCAATGGGAACGCCACAATGTACGC, WBGene00032830
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region