WormMine: Gene WBGene00032899

• WormBase Gene ID: WBGene00032899
• Gene Name: Cbr-che-3
• Sequence Name: CBG11853
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable several functions, including ATP binding activity; dynein intermediate chain binding activity; and dynein light intermediate chain binding activity. Predicted to be involved in microtubule-based movement. Predicted to be part of dynein complex. Is an ortholog of C. elegans che-3. In C. elegans, che-3 is involved in several processes, including dauer entry; non-motile cilium assembly; and positive regulation of dauer larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11853.1	CBG11853.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11853	CBG11853		[unknown]

0 RNAi Result

28 Allele

• WBVar00117948
• WBVar00117947
• WBVar00117949
• WBVar00117944
• WBVar00117943
• WBVar00117946
• WBVar00117945
• WBVar00117951
• WBVar00117950
• WBVar00117953
• WBVar00117952
• WBVar00117942
• WBVar00117959
• WBVar00117958
• WBVar00117955
• WBVar00117954
• WBVar00117957
• WBVar00117956
• WBVar00117962
• WBVar00117961
• WBVar00117960
• WBVar00057684
• WBVar00057689
• WBVar00014192
• WBVar00014187
• WBVar00014182
• WBVar00014177
• WBVar00026214

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr1060153
• Remark: Cbr-che-3, ATCCGTCGACGAACCATTCCTCTTTGGTCTTCCCGAAAATATCAAATATTCATGGCAAAT, WBGene00032899
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1050808
• Remark: CBG11857, TTCTATCCGAACATCTTCTTGAATGCATTGAGACAAACCACGTCTCGACAACTCCAAATT, WBGene00032902
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region